Identification and expression analysis of irak1 gene in common carp Cyprinus carpio L.: indications for a role of antibacterial and antiviral immunity.

In this study, the full-length complementary (c)DNA of interleukin-1 receptor-associated kinase 1 gene (irak1) was cloned from common carp Cyprinus carpio. The complete open reading frame of irak1 contained 2109 bp encoding a protein of 702 amino acid residues that comprised a death domain, a ProST region, a serine-threonine-specific protein kinase catalytic domain and a C-terminal domain. The amino-acid sequence of C. carpio Irak1 protein shared sequence homology with grass carp Ctenopharyngodon idellus (84.5%). The phylogenetic tree of IRAKs separated the polypeptides into four clades, comprising IRAK1s, IRAK2s, IRAK3s and IRAK4s. Cyprinus carpio Irak1 fell into the cluster with previously reported IRAK1s including teleost Irak1s. The irak1 gene was highly expressed in gills, followed by brain, skin, hindgut, buccal epithelium, spleen, foregut, head kidney and liver, and was expressed at lowest levels in gonad and muscle. The irak1 messenger (m)RNA expression was up-regulated in liver, spleen, head kidney, foregut, hindgut, gills and skin after stimulation with Vibrio anguillarum and poly(I:C), and significantly high up-regulated expression was observed in liver and spleen. These results implied that irak1 might participate in antibacterial and antiviral innate immunity. These findings gave the indications that irak1 may participate in antibacterial and antiviral immunity.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response.

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Association of novel single nucleotide polymorphisms of the CXCR1 gene with the milk performance traits of Chinese native cattle.

Mastitis is an economically devastating disease affecting the dairy industry. Dairy cows with mastitis give reduced milk yield and produce milk that is unfit for consumption. The chemokine receptor CXCR1 is an excellent prospective genetic marker for mastitis resistance in cattle because it regulates neutrophil migration, killing, and survival during infection. We detected 4 single nucleotide polymorphisms (SNPs) of the CXCR1 gene in Chinese native cattle and analyzed their associations with milk traits. Screening for genetic variations in CXCR1 among 648 Chinese Holstein, Luxi Yellow, and Bohai Black cattle by created restriction site polymerase chain reaction (PCR), nested PCR, and DNA sequencing revealed 4 new SNPs with allelic frequencies ranging from 0.676 to 0.821, 0.706 to 0.803, 0.647 to 0.824, and 0.558 to 0.581. All four CXCR1 gene SNPs were located in exon II. Two SNPs, c.337A>G and c.365C>T, were nonsynonymous mutations [ATC (Ile) > GTC (Val) and GCC (Ala) > GTC (Val)], whereas two, c.291C>T and c.333C>T, were synonymous mutations [TTC (Gly) > TTT (Gly) and GGC (Phe) > GGT (Phe)]. Statistical analyses revealed the significant association of c.337A>G and c.365C>T with the somatic cell score, which suggests the possible role of these SNPs in the host response against mastitis. Our data suggest that combined genotypes CCAC/CCGC, CCAC/CTAT, and CCAT/CTAT (lowest somatic cell scores); CTAC/CTAT (highest protein rate); CCAC/CTGC (highest fat rate); and CCAT/CTAT (highest 305-day milk yield) can be used as possible candidates for marker-assisted selection in dairy cattle breeding programs.

Nuclear pseudogenes of mitochondrial DNA as a variable part of the human genome.

Novel pseudogenes homologous to the mitochondrial (mt) 16S rRNA gene were detected via different approaches. Eight pseudogenes were sequenced. Copy number polymorphism of the mtDNA pseudogenes was observed among randomly chosen individuals, and even among siblings. A mtDNA pseudogene in the Y-chromosome was observed in a YAC clone carrying only repetitive sequence tag site (STS). PCR screening of human yeast artificial chromosome (YAC) libraries showed that there were at least 5.7 x 10(5) bp of the mtDNA pseudogenes in each haploid nuclear genome. Possible involvement of the mtDNA pseudogenes in the variable part of the human nuclear genome is discussed.